Introduction
Bronchopulmonary dysplasia (BPD) is a common chronic disorder of the respiratory system in preterm infants, particularly in very premature infants. BPD is characterized by alveolar dysplasia and a reduced number of alveoli, alveolar simplification, capillary dysplasia and other symptoms [1]. The incidence of BPD is 12-32% in preterm infants at <32 weeks of gestation [2] and may rise to as high as 50% in infants with extremely low birth weights (<1,000 g) or extremely low gestational age (<28 weeks) [3]. The incidence of BPD has been increasing for years and the lack of effective therapeutic measures has severely affected the outcomes and survival of BPD infants. Epidemiological studies have shown that BPD is a complex disease and many factors, including oxygen exposure time, mechanical ventilation and strength, inflammatory reactions, lung tissue immaturity, damage and other factors may lead to BPD [4]. Additionally, studies have shown that stem cells may effectively interfere with the development of BPD [5,6].
Tyrosine-Protein Kinase Kit (KIT) is a transmembrane protein receptor associated with germ cell maturation [7] and is encoded by the human homolog of the proto- oncogene c-kit. It serves an important role in regulating cell proliferation, hematopoiesis and stem cell maintenance. KIT activation has been shown to exhibit oncogenic activity in gastrointestinal stromal tumors (GISTs), melanomas, lung cancer, and other types of tumors. The targeted therapeutics, nilotinib and sunitinib, exhibit efficacy in treating KIT overactive patients in late-stage trials in patients with melanoma and GIST. KIT over activity may be the result of numerous genomic events, including genomic amplification, overexpression and missense mutations. Missense mutations have been demonstrated to be key players in mediating clinical response and acquired resistance in patients being treated with this targeted therapeutics. Furthermore, Kit ligand polymorphisms are associated with susceptibility to moderate- to-severe BPD [8-10].
Vascular endothelial growth factor (VEGF) is a central factor in angiogenesis and its expression levels affect pulmonary vascular development, consequently impacting the development and progression of BPD [11]. VEGF is primarily produced by alveolar epithelial cells and exerts effects on endothelial cell migration, survival, proliferation, and differentiation, and it is an essential regulatory factor required for the growth and maintenance of pulmonary vasculature during the embryonic, fetal and postnatal stages [12]. Deficiency of VEGF may affect the formation of a normal fetal pulmonary capillary system, leading to reduced capillary bed density, alveolar simplification and impaired alveolar development [13], thereby increasing the incidence of BPD in neonates. These observations demonstrate the essential role of VEGF in maintaining normal lung development. Additionally, pulmonary angiogenesis is strongly influenced by VEGF-A. VEGF-A is a specific mitogen and survival factor in vascular endothelial cells, and it is expressed by distal airspace epithelial cells in both the fetal and postnatal lung [14]. Common polymorphisms of the gene encoding VEGF-A are associated with lung function in both children and in adults [15].
Based on previous studies, a comprehensive analysis strategy was used on the GSE25286 gene expression profile obtained from Gene Expression Omnibus (GEO), the associations between VEGF expression, disease-related genes and differentially expressed genes (DEGs) were determined, and a protein-protein interaction (PPI) network was constructed. Additionally, in a mouse model of BPD, the effects of KIT expression on the maintenance of pulmonary vascular formation and alveolar growth were evaluated and the underlying mechanisms were studied. The results of these experiments demonstrated the protective effects of KIT on BPD and highlight KIT as a candidate therapeutic target for the treatment of BPD.
Materials and Methods
Bioinformatics analysis
The GSE25286 profile and the corresponding platform annotation files were obtained from the GEO database (ncbi.nlm. nih.gov/geo/query/acc.cgi?acc=GSE25286). A Limma Microarray/ Counts test for DEGs was performed, and genes with fold changes (FCs) >1 and an adjusted P<0.05 were considered further.
The DEGs between BPD and control lung tissues, with high or low mRNA expression levels were computed using the R package “limma”. In total, DEGs with an absolute log2 FC ≥1 and an adjusted P<0.05 were considered analyzed further using univariate Cox regression analysis. Adjusted P-values for multiple tests were determined using Benjamini-Hochberg correction.
The PPI network was generated using the Search Tool for Recurring Instances of Neighboring Genes (STRING) database (string-db.org) and Cytoscape software was used to create the images based on the STRING results.
Establishment of a hyperoxia-induced BPD model
A total of 9 newborn FVB mice, a common genetic research model which was not particularly relevant in hyperoxia studies and 2 mothers were exposed to 75% oxygen in an organic glass chamber or normal indoor air at the time of birth and reared continuously for 14 days. An oxygen concentration controller (BioSpherix, Ltd.) was used to adjust air flow, maintain the oxygen concentration in the chamber at 75%, and remove CO2, ensuring that CO2 concentration never exceeded 0.5%. Ammonia was filtered through an air purifier and activated charcoal. Normoxic and hyperoxic mother mice were swapped every 48 h to prevent oxygen toxicity in mother mice.
For the hyperoxic group (n=3), the newborn FVB mice were reared in 75% oxygen conditions for 2 weeks starting from postnatal day 1 (within 6 h of birth). For the normoxic group (n=6), the newborn FVB mice were reared in normal room air for 2 weeks starting from birth. When chronic hyperoxia injury became obvious in the BPD model on day 14 [16], mice were placed in normal room air, and the hyperoxic mice were randomly divided into three groups as follows: Hyperoxia model group (n=2), hyperoxia model + negative control (NC) group (n=2), and hyperoxia model + KIT group (n=2). The normoxia group and hyperoxia model group were placed in normal room air and reared for 2 weeks. The hyperoxia model + NC group were intravenously/intramuscularly injected with NC lentivirus, and the hyperoxia model + KIT group were intravenously/intramuscularly injected with KIT overexpression lentivirus; both groups were placed in normal room air and reared for 2 weeks. Each group of neonatal mice was allowed to recover for 2 weeks and subsequently, the mice were anesthetized with chloral hydrate (400 mg/kg) and sacrificed by cervical dislocation. Lung tissues were collected for histological and immunohistochemical studies as described below.
Mice were housed under controlled environmental conditions with free access to water and food, and 12-hour alternating light/ dark cycles. Animal care and handling were conducted according to the guidelines of the Medical Ethics Committee and Institutional Review Board of the Second People’s Hospital of Nanning, China.
Measurement of respiratory system resistance
To evaluate respiratory system resistance in newborn mice, an ultrasound nebulizer (SCIREQ Scientific Respiratory Equipment, Inc) was used to nebulize normal saline and methacholine (1.6, 5, 10, 16, or 50 mg/ml) for inhalation. Mean airway resistance was calculated at the baseline time, and the maximum value for each methacholine dose was subsequently recorded.
Masson’s trichrome staining. Alveolar tissue was stained using Masson’s trichrome stain. Alveolar cells were dehydrated and embedded for paraffin sectioning. The nucleus was stained using hematoxylin for 15 min and then ponceau S acid solution for 10 min. Slides were treated with phosphomolybdic acid solution for 5 min, counterstained in aniline for 5 min, dehydrated multiple times, and mounted. Alveolar tissue fibrosis and the status of alveolar remodeling were analyzed in each group.
Immunohistochemistry
Lung tissue was dehydrated and embedded for sectioning. Sections were incubated with CD31 primary antibody (rabbit anti-mouse; 1:100; cat. no. 77699; Cell Signaling Technology, Inc.), transforming growth factor (TGF)-β primary antibody (rabbit antimouse; 1:100; Sigma-Aldrich; Merck KGaA; cat. no. SAB4504269), type II collagen (COL II) primary antibody (rabbit anti-mouse, 1:100 dilution; Sigma-Aldrich; Merck KGaA; cat. no. SAB4500362), or type V collagen (COL V) primary antibody (rabbit anti-mouse; 1:100 dilution; Abcam; cat. no. ab7046) overnight at 4°C. Goat anti-rabbit secondary antibody was used at a dilution of 1:1000 for 30 min at room temperature. Color was developed by staining with 3,3’- Diaminobenzidine for 30 sec, and hematoxylin counterstaining was performed for 15 min. The slides were dehydrated and mounted for immunohistochemical analysis.
Lentivirus and KIT overexpression
The cDNA sequence of KIT was obtained from GenBank (NM_000222.2). The coding region of KIT was obtained by PCR using primers (forward: 5’- CAGCTACCGCGATGAGAG-3’; reverse: 5’- GGGATTTATATATGTACATTTTATTAG AAT-3’) and then inserted into the pLVX- shRNA1 vector (Clontech Corporation) using the BamHI and EcoRI restriction sites. Lentiviruses were generated using the pLVX-shRNA1 vector containing the coding sequence of KIT. Lentivirus was intravenously/intramuscularly administrated to the mice and the number of viral particles administered to each mouse was 1×106.
mRNA expression levels of KIT and VEGF. Lv-KIT (KIT overexpression vector) and short hairpin (sh)-VEGF (VEGF knockdown vector) were transfected into cells, either alone or together, to determine the effects of VEGF on functional changes in the lung caused by KIT overexpression. The mRNA expression levels of KIT and VEGF were measured by RT-qPCR in 293T cells, which was used as the intermediate cell-line for gene reconstruction. Fulllength cDNA encoding human VEGF was amplified from first-strand cDNA derived from the 293T cell line with an RNeasy plus mini kit (QIAGEN), High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), Phusion HF DNA polymerase (Finnzymes).
Reverse transcription-quantitative (RT-q) PCR. Gene expression in whole lungs tissues were analyzed using RT-qPCR with specific primers (Applied Biosystems; Thermo Fisher Scientific, Inc.). Total RNA was extracted using an RNeasy Mini kit (Qiagen, Inc). qPCR was performed using Real Time TaqMan on an ABI Prism 7700 sequence detection system. The sequences of the primers were as follows: KIT forward, 5’- GCACAATGGCACGGTTGAAT-3’ and reverse, 5’-GGTGTGGGGATGGATTTGCT- 3’; VEGF-A forward, 5’-CTCTCTCTCCCAGATCGGTGA-3’ and reverse, 5’- CAAAGGAATGTGTGGTGGGGA-3’; and GAPDH forward, 5’- TTCCACCTTTGATGCTGGGG-3’, and reverse, 5’-CCACCACCCTGTTGCTGTAG-3’. GAPDH was used as the internal control.
Statistical analysis
Data are presented as the mean ± standard deviation using SPSS version 17.0 (SPPS, Inc). Statistical significance between >2 groups was determined using bonfferoni after a one-way ANOVA analysis, and a t-test was used to compare two groups. P<0.05 was considered to indicate a statistically significant difference.
To read more about this article....Open access Journal of Pediatrics & Neonatal Care
Please follow the URL to access more information about this article
